文档搜索 > Untitled

Untitled

Page 1

Page 2
Copyright © 2013 IFSA Publishing. All rights reserved. This journal and the individual contributions in it are protected under copyright by IFSA Publishing, and the following terms and conditions apply to their use: Photocopying: Single photocopies of single articles may be made for personal use as allowed by national copyright laws. Permission of the Publisher and payment of a fee is required for all other photocopying, including multiple or systematic copyright, copyright for advertising or promotional purposes, resale, and all forms of document delivery. Derivative Works: Subscribers may reproduce tables of contents or prepare list of articles including abstract for internal circulation within their institutions. Permission of the Publisher is required for resale or distribution outside the institution. Permission of the Publisher is required for all other derivative works, including compilations and translations. Authors' copies of Sensors & Transducers journal and articles published in it are for personal use only. Address permissions requests to: IFSA Publisher by e-mail: editor@sensorsportal.com Notice: No responsibility is assumed by the Publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein.
Printed in the USA.

Page 3
Sensors & Transducers
Volume 149, Issue 2, February 2013 www.sensorsportal.com ISSN 1726-5479
Editors-in-Chief: professor Sergey Y. Yurish, Tel.: +34 696067716, e-mail: editor@sensorsportal.com
Editors for Western Europe
Meijer, Gerard C.M., Delft Univ. of Technology, The Netherlands Ferrari, Vittorio, Universit?? di Brescia, Italy
Editor for Eastern Europe
Sachenko, Anatoly, Ternopil National Economic University, Ukraine
Editors for North America
Katz, Evgeny, Clarkson University, USA Datskos, Panos G., Oak Ridge National Laboratory, USA Fabien, J. Josse, Marquette University, USA
Editor South America
Costa-Felix, Rodrigo, Inmetro, Brazil
Editors for Asia
Ohyama, Shinji, Tokyo Institute of Technology, Japan Zhengbing, Hu, Huazhong Univ. of Science and Technol., China
Editor for Asia-Pacific
Mukhopadhyay, Subhas, Massey University, New Zealand
Editor for Africa
Maki K.Habib, American University in Cairo, Egypt
Editorial Board
Abdul Rahim, Ruzairi, Universiti Teknologi, Malaysia Abramchuk, George, Measur. Tech. & Advanced Applications, Canada Ascoli, Giorgio, George Mason University, USA Atalay, Selcuk, Inonu University, Turkey Atghiaee, Ahmad, University of Tehran, Iran Augutis, Vygantas, Kaunas University of Technology, Lithuania Ayesh, Aladdin, De Montfort University, UK Baliga, Shankar, B., General Monitors, USA Basu, Sukumar, Jadavpur University, India Bousbia-Salah, Mounir, University of Annaba, Algeria Bouvet, Marcel, University of Burgundy, France Campanella, Luigi, University La Sapienza, Italy Carvalho, Vitor, Minho University, Portugal Changhai, Ru, Harbin Engineering University, China Chen, Wei, Hefei University of Technology, China Cheng-Ta, Chiang, National Chia-Yi University, Taiwan Chung, Wen-Yaw, Chung Yuan Christian University, Taiwan Cortes, Camilo A., Universidad Nacional de Colombia, Colombia D'Amico, Arnaldo, Universit?? di Tor Vergata, Italy De Stefano, Luca, Institute for Microelectronics and Microsystem, Italy Ding, Jianning, Changzhou University, China Djordjevich, Alexandar, City University of Hong Kong, Hong Kong Donato, Nicola, University of Messina, Italy Dong, Feng, Tianjin University, China Erkmen, Aydan M., Middle East Technical University, Turkey Gaura, Elena, Coventry University, UK Gole, James, Georgia Institute of Technology, USA Gong, Hao, National University of Singapore, Singapore Gonzalez de la Rosa, Juan Jose, University of Cadiz, Spain Guillet, Bruno, University of Caen, France Hadjiloucas, Sillas, The University of Reading, UK Hui, David, University of New Orleans, USA Jaffrezic-Renault, Nicole, Claude Bernard University Lyon 1, France Jamil, Mohammad, Qatar University, Qatar Kaniusas, Eugenijus, Vienna University of Technology, Austria Kim, Min Young, Kyungpook National University, Korea Kumar, Arun, University of Delaware, USA Lay-Ekuakille, Aime, University of Lecce, Italy Li, Si, GE Global Research Center, USA Lin, Paul, Cleveland State University, USA Liu, Aihua, Chinese Academy of Sciences, China Mansor, Muhammad Naufal, University Malaysia Perlis, Malaysia Marquez, Alfredo, Centro de Investigacion en Materiales Avanzados, Mexico Mishra, Vivekanand, National Institute of Technology, India Moghavvemi, Mahmoud, University of Malaya, Malaysia Morello, Rosario, University "Mediterranea" of Reggio Calabria, Italy Mulla, Imtiaz Sirajuddin, National Chemical Laboratory, Pune, India Nabok, Aleksey, Sheffield Hallam University, UK Neshkova, Milka, Bulgarian Academy of Sciences, Bulgaria Passaro, Vittorio M. N., Politecnico di Bari, Italy Penza, Michele, ENEA, Italy Pereira, Jose Miguel, Instituto Politecnico de Setebal, Portugal Pogacnik, Lea, University of Ljubljana, Slovenia Pullini, Daniele, Centro Ricerche FIAT, Italy Reig, Candid, University of Valencia, Spain Restivo, Maria Teresa, University of Porto, Portugal Rodr??guez Mart??nez, Angel, Universidad Polit??cnica de Cataluña, Spain Sadana, Ajit, University of Mississippi, USA Sadeghian Marnani, Hamed, TU Delft, The Netherlands Sapozhnikova, Ksenia, D. I. Mendeleyev Institute for Metrology, Russia Singhal, Subodh Kumar, National Physical Laboratory, India Shah, Kriyang, La Trobe University, Australia Shi, Wendian, California Institute of Technology, USA Shmaliy, Yuriy, Guanajuato University, Mexico Song, Xu, An Yang Normal University, China Srivastava, Arvind K., LightField, Corp, USA Stefanescu, Dan Mihai, Romanian Measurement Society, Romania Sumriddetchkajorn, Sarun, Nat. Electr. & Comp. Tech. Center, Thailand Sun, Zhiqiang, Central South University, China Sysoev, Victor, Saratov State Technical University, Russia Thirunavukkarasu, I., Manipal University Karnataka, India Tianxing, Chu, Research Center for Surveying & Mapping, Beijing, China Vazquez, Carmen, Universidad Carlos III Madrid, Spain Wang, Jiangping, Xian Shiyou University, China Xue, Ning, Agiltron, Inc., USA Yang, Dongfang, National Research Council, Canada Yang, Shuang-Hua, Loughborough University, UK Yaping Dan, Harvard University, USA Zakaria, Zulkarnay, University Malaysia Perlis, Malaysia Zhang, Weiping, Shanghai Jiao Tong University, China Zhang, Wenming, Shanghai Jiao Tong University, China Sensors & Transducers Journal (ISSN 1726-5479) is a peer review international journal published monthly online by International Frequency Sensor Association (IFSA). Available in both: print and electronic (printable pdf) formats. Copyright © 2013 by International Frequency Sensor Association. All rights reserved.

Page 4
Sensors & Transducers Journal
Contents
Volume 149 Issue 2 February 2013
www.sensorsportal.com
ISSN 2306-8515 e-ISSN 1726-5479
Research Articles
NaCl/TiO2 and NaCl/Al2O3 Resistive and CapacitiveHumidity Sensors Sheyla Jim??nez, Luciana Scarioni and Kelim Vano .................................................................. 1 Effect of Annealing Temperature on Ag-NaCl/TiO2-Ag and Ag-NaCl/Al2O3–Ag Capacitive and Resistive Humidity Sensors Sheyla Jim??nez, Luciana Scarioni and Kelim Vano .................................................................. 6 Ethanol Gas Sensing Properties of Nano-Porous LaFeO3 Thick Film S. M. Khetre ............................................................................................................................... 13 Fabrication of a Gold Nanostar - Embedded Porous Poly(dimethylsiloxan) Platform for Sensing Applications Nikhila Anand, Shishira Venkatesh, Pramod Putta, Stefan Stoenescu, Simona Badilescu, Muthukumaran Packirisamy, Vo-Van Truong ............................................................................ 20 A New Hydrogen Sensor with Nanostructured Zinc Magnesium Oxide Sachin Bangale, Reshma Prakshale, Damayanti Kambale, Arun Chopade, Chandrakant Kolekar, Sambhaji Bamane........................................................................................................ 29 Study of Gaseous Compounds Adsorption with a Love Wave Sensor Based on Molecularly Imprinted Polymeric Thin Film N. Omar Aouled, N. Lebal, H. Hallil, R. Del??p??e, L. Agrofoglio, D. Rebi??re, C. Dejous......... 37 Molybdenum Doped SnO2 Thin Films as a Methanol Vapor Sensor Patil Shriram B. More Mahendra A. and Patil Arun V............................................................. 43 Performance of Hexagon Au Electrode on ZnO Thin Film Schottky Diode Gas Sensor Mas Elyza Mohd Azol, Mahnaz Shafiei, Pei Ling Leow, Kai Long Foo, Uda Hashim and Rashidah Arsat.................................................................................................................... 49 Synthesis of Nanocrystalline ZnS Thin Films via Spray Pyrolysis for Optoelectronic Devices F. Rahman, M. Zahan and J. Podder......................................................................................... 54 Surface Plasmon Resonance Biosensor Nina Gridina, Gleb Dorozinsky, Roman Khristosenko, Vladimir Maslov, Anton Samoylov, Yury Ushenin, Yury Shirshov. .................................................................................................... 60 Synthesis and Characterization of Pure and Al Modified BaSnO3 Thick Film Resistor and Studies of its Gas Sensing Performance N. U. Patil, V. B. Gaikwad, P. D. Hire, R. M. Chaudhari, M. K. Deore, G. H. Jain..................... 69 Embedded Piezoresistive Microcantilever Sensors Functionalized for the Detection of Methyl Salicylate Timothy L. Porter, Richard J. Venedam..................................................................................... 76

Page 5
A Biosensor for the Detection and Estimation of Cholesterol Levels based on Long Period Gratings C. Bobby Mathews, T. M. Libish, J. Linesh, P. Biswas, S. Bandyopadhyay, K. Dasgupta, P. Radhakrishnan................................................................................................. 83 Electrochemical Sensors for Detecting Mn (II) in Blood Medium Muhammed Mizher Radhi, Nawfal Khalid Al-damlooji, Baquir Kareem Abed, Dawood Salman Dawood, and Tan Wee Tee.......................................................................................... 89 Design Considerations for Development of a Magnetic Bead Based Biosensor Wen-Yaw Chung, Kimberly Jane Uy, Yi Ying Yeh, Ting Ya Yang, Hao Chun Yang, Yaw- Jen Chang, T. Y. Chin, Kuang-Pin Hsiung, Dorota G. Pijanowska. .......................................... 94 Modeling of pH Dependent Electrochemical Noise in Ion Sensitive Field Effect Transistors ISFET M. P. Das and M. Bhuyan .......................................................................................................... 102 Effects of Dimethyl Methylphosphonate on the Triboluminescent Properties of Europium Dibenzoylmethide Triethylammonium Ross S. Fontenot, Kamala N. Bhat, William A. Hollerman and Mohan D. Aggarwal................. 109 A Design of Portable Pesticide Residue Detection System Based on the Enzyme Electrode Xia Sun, Xiaoxu Sun, Xiangyou Wang....................................................................................... 116 Colorimetric DNA Based Biosensor Combined with Loop-mediated Isothermal Amplification for Detection of Mycobacterium tuberculosis by Using Gold Nanoprobe Aggregation Thongchai Kaewphinit, Somchai Santiwatanakul and Kosum Chansiri. ................................... 123 Frequency Domain Analysis of Intracellular Ion Transport through Lipid Bilayer Membrane Based on Aldosterone Activity Concomitant with Neurohormonal Interaction Suman Halder. ........................................................................................................................... 129 Electrochemical Characterization of Enzymatic Impedimetric Biosensor Destined to Detect Organochlorine Pesticide: the Diclofop-methyl S. Baali, S. Zougar, R. Kherrat, Z. Djeghaba, F. Benamia, N. Jaffrezic-Renault ...................... 135 Development of QCM Immunosensor with Small Sample Solution for Detection of MMP-3 Antibody Setyawan P. Sakti, Farida Wahyuni, Unggul P. Juswono, Aulanni??am. .................................... 143 A Novel Label-free Immunosensor Based on L-cysteine/deposited Gold Nanocrystals for the Chlorpyrifos Detection Xia Sun, Guanghui Shen, Xiangyou Wang, Yan Zhang, Jinmei Gao........................................ 149 Fabrication of an Electrochemical Immunosensor for Carbofuran Detection Based on a Nanocomposite Film Shuyuan Du, Lu Qiao, Xiangyou Wang, Xia Sun. ..................................................................... 156 Detection of Tuberculosis Using Biosensors: Recent Progress and Future Trends Damira Kanayeva, Ildar Bekniyazov, Zhannat Ashikbayeva. .................................................... 166 Bacteria Identification by Phage Induced Impedance Fluctuation Analysis (BIPIF) Gabor Schmera and Laszlo B. Kish........................................................................................... 174 Detection of Ionization Radiation Effect Using Microorganism (Escherichia Coli) Maytham Al-Shanawa, A. Nabok, A. Hashim, T. Smith............................................................. 179

Page 6
Study to Eliminate the Effect of Hyperbilirubinemia in Measurement of Blood Coagulation Assay Raghunathan R, Neelamegam P, Jamaludeen. A, Murugananthan K. ..................................... 187 Gas Detection by Drift and Diffusion Characteristics in a Porous Medium Aboozar Parvizi, Mohammad Orvatinia, Najmeh Khabazi Kenari. ............................................ 193 Odour Profile of Beef Using an Electronic Nose Based on MOS-Sensor Gabriela Grigioni, Fernanda Paschetta, Trinidad Soteras, Valeria Messina. ............................ 199
Authors are encouraged to submit article in MS Word (doc) and Acrobat (pdf) formats by e-mail: editor@sensorsportal.com. Please visit journal??s webpage with preparation instructions: http://www.sensorsportal.com/HTML/DIGEST/Submition.htm International Frequency Sensor Association (IFSA).

Page 7
Sensors & Transducers, Vol. 149, Issue 2, February 2013, pp. 123-128
123
Sensors & Transducers
© 2013 by IFSA http://www.sensorsportal.com
Colorimetric DNA Based Biosensor Combined with Loop-mediated Isothermal Amplification for Detection of Mycobacterium Tuberculosis by Using Gold Nanoprobe Aggregation
1
Thongchai KAEWPHINIT,
2
Somchai SANTIWATANAKUL and
1
Kosum CHANSIRI
1 Department of Biochemistry, Faculty of Medicine, Srinakharinwirot University,
Sukhumvit 23, Bangkok, 10110, Thailand Tel.: +66 2260-2122 ext 4605, fax: +66 2260-0125.
2 Department of Pathology, Faculty of Medicine, Srinakharinwirot University,
Sukhumvit 23, Bangkok, 10110, Thailand E-mails: tkaewphinit@yahoo.com, kosum@swu.ac.th, titi41@yahoo.com Received: 4 November 2013 /Accepted: 14 February 2013 /Published: 28 February 2013
Abstract: Tuberculosis is a persistent problem in the developing world and the biggest cause of mortality. Loop-mediated isothermal amplification (LAMP) allows DNA to be amplified rapidly at a constant temperature. Here, a LAMP method was combined with a gold nanoparticle (AuNPs) probes to detect IS6110 of M. tuberculosis rapidly, and specifically. The reaction amplified DNA and hybridized to thiol modified oligonucleotide probe for 5 min was detected at AuNPs color change 5 min after application. Excluding for the step of DNA extraction, test results could be generated approximately within 1 h. Furthermore, the data indicated that LAMP-AuNPs could detect serial dilution of M. tuberculosis DNA limited as 5 pg of genomic DNA. According to the sensitivity, specificity, less time consuming, low cost and convenience, this technique may prove to be a powerful tool for the early diagnosis of M. tuberculosis. Copyright © 2013 IFSA. Keywords: Loop-mediated isothermal amplification; LAMP; Gold nanopaticles; AuNPs; Mycobacterium tuberculosis.
1. Introduction
Tuberculosis (TB) is a disease caused by Mycobacterium spp. It is among the top ten causes of global mortality and morbidity, constitutes an important public health problem in Thailand. Mycobacterium needs 1–2 months in culture to grow. Besides, The Ziehl-Neelsen (ZN) stain for direct specimen examination, a conventional diagnostic tool, lacks sensitivity. A rapid and timely diagnosis of tuberculosis is thus essential to combat this disease. The need for rapid and sensitive detection of M. tuberculosis has resulted in the introduction of various molecular PCR methods in the routine workflow of laboratories showing promise for the detection of mycobacteria in clinical samples [1-4]. Recently, colorimetric based methods by Baptista et al. applied gold nanoparticles (AuNPs) for color change upon aggregation either mediated by a change to the dielectric medium or by recognition of a specific DNA target. The design of these systems is
Article number P_1137

Page 8
Sensors & Transducers, Vol. 149, Issue 2, February 2013, pp. 123-128
124
centered in the ability of complementary targets to balance and control inter-particle attractive and repulsive forces between molecules, which determine whether AuNPs are stabilized or aggregated and, AuNPs present a surface plasmon resonance (SPR) at 530 nm for the pink non aggregated from that red shifts to 650 nm for blue or purple upon AuNPs aggregated in solution [5]. In 2006, Baptista et al. introduced the first application of AuNPs to detect of M. tuberculosis [6]. This assay consists in differential stabilization of AuNPs probes in the presence of different DNA targets. The complementary DNA targets were protected AuNPs probes aggregation and the solution remains red or pink, while their absence DNA targets or non-complementary/mismatched do not protect AuNPs probes aggregation, resulting in a visible colour change from red to blue or purple. This method was applied using AuNPs probes functionalized with thiol-modified oligonucleotides specific RNA polymerase ??-subunit gene sequence of M. tuberculosis suitable for mycobacteria identification in clinical samples. The method combined with PCR for target amplification showed high sensitivity [6]. But introducing an amplification step requires additional processing time, reagents and devices, which affect the cost of assay. Besides, PCR analysis requires expertise and highly sophisticated settings making it too expensive for a laboratory in a developing country. In 2000, Notomi et al., presented a novel molecular technique as loop-mediated isothermal amplification (LAMP) that has the ability to accurately amplify a few copies of DNA to 109 in less than an hour under isothermal conditions with great accuracy. This technique is fast, highly sensitivity, easy to apply, and cheap [7]. The LAMP method allows DNA to be amplified at a constant temperature of 60–65 ??C [7]. After LAMP, the amplified DNA is normally detected by agarose gel electrophoresis, ethidium bromide staining and UV transillumination. Due to the use of several primers, LAMP generates a complex mixture of DNA products of different size, and thus gel analysis cannot distinguish between specific- and non-specific products. To avoid possible false positive results, the authenticity of LAMP DNA products can be confirmed by restriction endonuclease digestion [7] or by hybridization with specific probes [8]. Besides, this method avoids the hazard of carcinogenic ethidium bromide as electrophoresis analysis is not required. The LAMP has led to the early diagnosis for the rapid detection of M. tuberculosis in clinical samples [9-14]. In this paper, we propose AuNPs-based colorimetric probes combined with loop-mediated isothermal amplification for detection of Mycobacterium tuberculosis in clinical samples by using aggregation of the DNA probe, in which functionalized AuNPs are induced by an increasing salt concentration of MgSO4. The advantage of this technique is that it uses a LAMP-amplified genomic bacterial DNA target. Accordingly, it is sensitive, specific, fast, cheap, and convenient, this technique may prove to be a powerful tool for the early diagnosis of M. tuberculosis.
2. Materials and Methods
2.1. Samples and DNA Extraction
Two loops full of M. tuberculosis (H37RVKK11- 20) cultured on Lowenstein-Jensen slants medium following by Kaewphinit et al., 2010. [15, 16] which was extracted in 1 mL DNAzol® reagent by inverting the tube several times prior to centrifugation at 4,000 xg for 10 minutes. The DNA in supernatant was precipitated by adding 0.5 mL of cold absolute ethanol. The supernatant was discarded and the DNA pellet was washed twice with 1.0 mL of 70 % ethanol by inverting the tubes 3 times. The mixture was then centrifuged at 13,000 xg for 5 minutes to allow DNA to settle and ethanol was removed by decanting. Two microlitters of genomic DNA was used in the LAMP reaction.
2.2. LAMP Primers and LAMP Amplification
LAMP primers for M. tuberculosis were designed according to the published sequences of the IS6110 specific for M. tuberculosis genome (Gen-Bank accession no. X17348) using Primer Explorer version 4 (http://primerexplorer.jp/elamp4.0.0/index.html). The directions and details of the primers were shown in Fig. 1 and Table 1. The normal primers and biotin- labeled FIP primer were synthesized by Bio Basic Inc., Canada. The LAMP reactions were carried out at 63 ??C for 1 h, followed by the analysis of the LAMP products by 2 % agarose gel electrophoresis. The reaction mixture contained 2 µM each of inner primers FIP and BIP, 0.2 µM each of outer primers F3 and B3, 1.6 mM of dNTP mix (Promega, Madison, WI, USA), 0.5 M betaine (Sigma–Aldrich, St. Louis, MO, USA), 6 mM MgSO4, 8U of Bst DNA polymerase (large fragment; New England Biolabs Inc., Beverly, MA, USA), 1?? of the supplied buffer, and 50 ng of DNA in a final volume of 25 µl.
2.3. Preparation of AuNPs Conjugated with Thiol Modified Oligonucleotide
Au colloidal (Sigma–Aldrich, St. Louis, MO, USA) was particle size (monodisperse) as 10 nm conjugated with 18-thiol terminated oligonucleotides were prepared following by Mirkin and college [17]. Place 20 µl of 5 nmol of thiol-modified DNA probe mixed 4 mL of Au colloidal in a tube, then the solution stand well by incubated shaking (100 rpm) at 45 ??C for 24 h. The solution was then transferred to buffer I (0.1M NaCl, 10mM phosphate buffer, and

Page 9
Sensors & Transducers, Vol. 149, Issue 2, February 2013, pp. 123-128
125
0.01 % SDS, pH 7), and allowed to stand for an additional 48 h. The solution was centrifuged for 20 min at 12,000 rpm twice to attain red precipitates. The resulting precipitates were then washed with 500 µL of a buffer I solution and then resuspended in 750 µL of a buffer II (0.3 M NaCl, 10 mM phosphate buffer, and 0.01 % SDS, pH 7) and immediately used.
Fig. 1. Nucleotide sequence of IS6110 (GenBank accession number: X17348). The primers F3 and B3 were shown as underlined nucleotide sequences. The FIP (F1c/TTTT/F2) and BIP (B1c/TTTT/B2) inner primers were color boxes and arrows. The thiol modified probe sequence was shown as italic and underlined sequences. Table 1. Primers and probe used for LAMP of the IS6110 of M. tuberculosis. Primer name Genome position Sequences 5??- 3?? F3 581-597 GCCAGATGCACCGTCGA B3 759-740 GACACATAGGTGAGGTCTGC FIP (F1c/TTTT/F2) 664-646/TTTT/604-623 AGCGATCGTGGTCCTG CGG-TTTT- GATGACCAAACTCGGCCTGT BIP (B1c/TTTT/B2) 682-699/TTTT/738-721 TCCCGCCGATCTCGTCCA-TTTTT- ACCCACAGCCGGTTAGGT Thiol modified probe 665-680 ATCCGGCCACAGCCC
2.4. LAMP Combined with AuNPs Probes Based Colorimetric Assay
A 5`-thiol modified oligonucleotide probe designed according to the IS6110 of M. tuberculosis between the F1c and B1c primer targets was synthesized by Bio Basic Inc., Canada. Detection of the existence of target DNA was achieved by the addition of 5 µl of each thiol modified oligonucleotide at the final concentration of 0.1 nmol mixed with the 5 µl of LAMP reaction was hybridized at 63 oC for 5 min, the hybridization of product was added to 5 µl of 0.3 M MgSO4 for 5 min. The positive reaction means a color change from red to purple and the aggregation of AuNPs probes color change from red to blue or purple (Fig. 2).
2.5. Sensitivity and Specificity of LAMP by Gel Electrophoresis and Colorimetric Assay
To determine detection sensitivity limits, 10-fold serial dilutions (10-1 to 10-6) of 50 ng of total DNA of M. tuberculosis standard strain culture were used as DNA template LAMP tests performed under optimized conditions. The specificity of LAMP primers was examined using 50 ng of total DNA extracted from other mycobacterium. These included infectious M. intracellulare, M. fortuitum, M. avium, M. kansasii, and M. gordonae. All LAMP products were analyzed by 2 % agarose gel electrophoresis, and by AuNPs probe.

Page 10
Sensors & Transducers, Vol. 149, Issue 2, February 2013, pp. 123-128
126
Fig. 2. Experimental schematic representation LAMP-AuNPs probes based colorimetric assay in this study. The assay consists on visual comparison of test solutions before and after MgSO4 induced AuNPs probes aggregation: (i) AuNPs probes alone as Blank; (ii) AuNPs probes in the presence of a non-complementary DNA sample as Negative; (iii) AuNPs probes in the presence of a complementary DNA sample as Positive.
2.6. PCR for M. Tuberculosis Detection
Ten-fold serial dilutions of 50 ng/µl of total DNA extracted from M. tuberculosis were used as the template for PCR detection of M. tuberculosis using the Thermal Cycler) Touchgene Gradient, model: FTGRAD2D, Techne Ltd.) according to the manufacturer??s protocol and using a method that targeted the IS6110 of M. tuberculosis [15]. The PCR products were detected by 2 % agarose gel electrophoresis followed by ethidium bromide staining and visualization on a UV transluminator.
3. Results and Discussion
3.1. Comparison of Sensitivity with Gel Electrophoresis
Using equivalent quantities of DNA extracted from M. tuberculosis (H37RVKK11-20) infected samples as DNA templates at various dilutions, detection limits for LAMP and PCR were both at 10−4 (5 pg of genomic DNA) (Fig. 3a - 3c). This assay corresponds to the detection limit for LAMP or PCR methods followed by electrophoresis, as described above. The detection limit was also similar to that of previously reported [14] and lower than Ayan et al [12]. But, the LAMP method carried out at 63 ??C for 60 min was faster than typical PCR methods that require 2–3 h for PCR cycling. No expensive equipment was required and results could be obtained in approximately 1 h 10 min (not including DNA preparation time) faster than LAMP followed by Ayan et al [12]. The LAMP–AuNPs based probes colorimetric assay for detection of M. tuberculosis showed a limit at 10−4 DNA dilution (5 pg of genomic DNA) as same as LAMP and PCR-gel electrophoresis. The colorimetric method is based on the colour change of an AuNPs probe in solution, upon increasing MgSO4 of salt concentration, in presence of either a complementary or a non-complementary target sequence. Fig.2 shows extensive AuNPs probes aggregation, noticeable by the blue colour of the respective solutions, followed by using 0.1 M MgSO4 of final concentration in the Blank and Negative samples. The Positive samples, however, included the complementary DNA that protected AuNPs probes aggregation. The solution retains the initial red colour (not shown), which is interpreted as hybridization of the DNA sequence on the AuNPs probes to its complementary DNA sequence became a double- stranded DNA structure, avoiding aggregation.
3.3. Specificity of LAMP-AuNPs Probe Based Colorimetric Assay
Specificity test was conducted using 50 ng each of M. tuberculosis DNAs and of other mycobacteria (i.e. M. intracellulare, M. fortuitum, M. avium, M. kansasii, and M. gordonae). The data revealed that no cross-reactions were obtained from LAMP-gel electrophoresis (Fig. 4 a) LAMP-AuNPs based probes colorimetric assay (Fig. 4 b). According to specificity test, there was no cross- reaction with other mycobacteria which indicating that the LAMP method was specific for M. tuberculosis. Combining the LAMP protocol with AuNPs probes based colorimetric assay for detection of amplicons reduced the time and complication associated with usual detection by electrophoresis, and it resulted in a total analysis time (excluding the DNA extraction step) to less than 75 min. The high sensitivity and specificity, the relatively short analysis time and the use of relatively inexpensive equipment are key advantages of this assay.

Page 11
Sensors & Transducers, Vol. 149, Issue 2, February 2013, pp. 123-128
127
Fig. 3. Detection sensitivity data of M. tuberculosis DNAs at concentration range of 10−1 to 10−6 dilutions (initial concentration was 50 ng) obtained from (a) PCR assay, (b) LAMP assay, and (c) LAMP-AuNPs probes based colorimetric assay; Lanes M and N represent DNA ladder marker and negative control (no-DNA template), respectively. Fig. 4. Specificity data test of the LAMP method by using 100 ng each of DNA templates and for detection of M. tuberculosis by (a) gel electrophoresis or by (b) LAMP-AuNPs based probe colorimetric assay. Lane M represents DNA ladder marker. Lanes 2-7 represent DNAs of M. tuberculosis (MTB), M. intracellulare (MIC), M. fortuitum (MFT), M. avium (MAV), M. kansasii (MKS), and M. gordonae (MGD), respectively. Lane 8 represent negative control (no-DNA template).
4. Conclusions
LAMP-AuNPs probes based colorimetric assay was used for detection of M. tuberculosis in clinical specimens. In this study, LAMP method was carried out at 63 ??C for 60 min which was faster than typical PCR methods that require 2–3 h for PCR cycling. The proposed test does not require expensive equipment and results could be determined within approximately 1 h (not including DNA preparation time). This assay was faster than LAMP-gel electrophoresis (2 h 30 min) and much faster than PCR - gel electrophoresis (3 h 30 min). LAMP detection method that targeted a 178 bp sequence of the IS6110 was successfully developed in the detection of M. tuberculosis standard strain limit as 5 pg of genomic DNA. According to the sensitivity, specificity, less time consuming, low cost and convenience, this technique may prove to be a powerful tool for the early diagnosis of M. tuberculosis. (c)

Page 12
Sensors & Transducers, Vol. 149, Issue 2, February 2013, pp. 123-128
128
Acknowledgments
This work was supported by Faculty of Medicine, Srinakharinwirot University and I would also like to acknowledge Bureau of Tuberculosis, Ministry of Public Health Thailand.
References
[1]. N. Ahmed, AK. Mohanty, U. Mukhopadhyay, V. K. Batish, S. Grover. PCR-based rapid detection of Mycobacterium tuberculosis in blood from immunocompetent patients with pulmonary tuberculosis. J. Clin. Microbiol., Vol. 36, 1998, pp. 3094-3095. [2]. A. Brisson-Noel, B. Gicquel, D. Lecossier, V. Levy- Frebault, X. Nassif, A. J. Hance, Rapid diagnosis of tuberculosis by amplification of mycobacterial DNA in clinical samples, Lancet, Vol. 2, 1992, pp. 1069-1071. [3]. P. Khandekar, A. Amin, P. Reddy, J. Banwalikar, C. Shivannaure, V. Katoch, Evaluation of PCR-based test for the detection of Mycobacterium Tuberculosis in coded sputum specimens, Indian J. Med. Res., Vol. 100, 1994, pp. 167-171. [4]. V. Sritharan, RH. Jr. Barker, A simple method for diagnosing M. Tuberculosis infection in clinical samples using PCR, Mol Cell Probes, Vol. 5, 1991, pp. 385-395. [5]. P. V. Baptista, G. Doria, D. Henriques, E. Pereira, R. Franco, Colorimetric detection of eukaryotic gene expression with DNA-derivatized gold nanoparticles, Journal of Biotechnology, Vol. 119, 2005, pp. 111-117. [6]. P. V. Baptista, M. Koziol-Montewka, J. Paluch-Oles, G. Doria, R. Franco, Goldnanoparticle-probe-based assay for rapid and direct detection of Mycobacterium tuberculosis DNA in clinical samples, Clinical Chemistry, Vol. 52, 2006, pp. 1433-1434. [7]. T. Notomi, H. Okayama, H. Masubuchi, et al. Loop- mediated isothermal amplification of DNA. Nucleic Acids Res, Vol. 28, Issue 12, 2000, pp. e63. [8]. Y. Mori, T. Hirano, T. Notomi. Sequence specific visual detection of LAMP reactions by addition of cationic polymers. BMC Biotechnol, Vol. 6, 2006, 3. [9]. T. Iwamoto, T. Sonobe, K. Hayashi, Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples, J. Clin. Microbiol., Vol. 41, 2003, pp. 2616-2622. [10]. C. C. Boehme, P. Nabeta, G. Henostroza, et al., Operational feasibility of using loop-mediated isothermal amplification for diagnosis of pulmonary tuberculosis in microscopy centers of developing countries, J. Clin. Microbiol,, Vol. 45, 2007, pp. 1936-1940. [11]. B. D. Pandey, A. Poudel, T. Yoda, et al., Development of an in-house loop-mediated isothermal amplification (LAMP) assay for detection of Mycobacterium tuberculosis and evaluation in sputum samples of Nepalese patients, J. Med. Microbiol., Vol. 57, 2008, pp. 439-443. [12]. E. Aryan, M. Makvandi, A. Farajzadeh, et al., A novel and more sensitive loop-mediated isothermal amplification assay targeting IS6110 for detection of Mycobacterium tuberculosis complex, Microbiol. Research, Vol. 165, 2010, pp. 211-220. [13]. M. F. Lee, Y. H. Chen, C. F. Peng, Evaluation of reverse transcription loop-mediated isothermal amplification in conjunction with ELISA- hybridization assay for molecular detection of Mycobacterium tuberculosis, J. Microbiol. Methods, Vol. 76, 2009, 174-180. [14]. R. Y. Zhu, K. X. Zhang, M. Q. Zhao, et al., Use of visual loop-mediated isotheral amplification of rimM sequence for rapid detection of Mycobacterium tuberculosis and Mycobacterium bovis, J. Microbio.l Methods, Vol. 78, 2009, pp. 339-343. [15]. T. Kaewphinit, S. Santiwatanakul, C. Promptmas, K. Chansiri, Detection of non-amplified Mycobacterium tuberculosis genomic DNA using piezoelectric DNA- based biosensors, Sensors, Vol. 10, 2010, pp. 1847-1858. [16]. T. Kaewphinit, S. Santiwatanakul, C. Promptmas, K. Chansiri, Development of piezoelectric DNA-based biosensor for direct detection of Mycobacterium tuberculosis in Clinical Specimens, Sensors and Transducers, Vol. 113, Issue 2, February 2010, pp. 115-126. [17]. C. A. Mirkin, R. L. Letsinger, R. C. Mucic, J. J. Storhoff, A DNA-based method for rationally assembling nanoparticles into macroscopic materials, Nature, Vol. 382, 1996, pp. 607-609.
___________________
2013 Copyright ©, International Frequency Sensor Association (IFSA). All rights reserved. (http://www.sensorsportal.com)

Page 13

Page 14
Aims and Scope
Sensors & Transducers is a peer reviewed international, interdisciplinary journal that provides an advanced forum for the science and technology of physical, chemical sensors and biosensors. It publishes original research articles, timely state-of-the-art reviews and application specific articles with the following devices areas: • Physical, chemical and biosensors; • Digital, frequency, period, duty-cycle, time interval, PWM, pulse number output sensors and transducers; • Theory, principles, effects, design, standardization and modeling; • Smart sensors and systems; • Sensor instrumentation; • Virtual instruments; • Sensors interfaces, buses and networks; • Signal processing and interfacing; • Frequency (period, duty-cycle)-to-code converters, ADC; • Technologies and materials; • Nanosensors; • Microsystems; • Applications. Further information on this journal is available from the Publisher's web site: http://www.sensorsportal.com/HTML/DIGEST/Submission.htm
Subscriptions
An annual subscription includes 12 regular issues and some special issues. Annual subscription rates for 2013 are the following: Electronic version (in printable pdf format): 400.00 EUR Printed with b/w illustrations: 640.00 EUR Printed full color version: 760.00 EUR 40 % discount is available for IFSA Members. Prices include shipping costs by mail. Further information about subscription is available through IFSA Publishing's web site: http://www.sensorsportal.com/HTML/DIGEST/Journal_Subscription.htm
Advertising Information
If you are interested in advertising or other commercial opportunities please e-mail sales@sensorsportal.com and your enquiry will be passed to the correct person who will respond to you within 24 hours. Please download also our Media Planner 2013: http://www.sensorsportal.com/DOWNLOADS/Media_Planner_2013.pdf
Books for Review
Publications should be sent to the IFSA Publishing Office: Ronda de Ramon Otero Pedrayo, 42C, 1-5, 08860, Castelldefels, Barcelona, Spain.
Abstracting Services
This journal is cited, indexed and abstracted by Chemical Abstracts, EBSCO Publishing, IndexCopernicus Journals Master List, ProQuest Science Journals, CAS Source Index (CASSI), Ulrich's Periodicals Directory, Scirus, Google Scholar, etc. Since 2011 Sensors & Transducers journal is covered and indexed by EI Compendex index (including a Scopus, Embase, Engineering Village and Reaxys) in Elsevier products.
Instructions for Authors
Please visit the journal web page http://www.sensorsportal.com/HTML/DIGEST/Submission.htm Authors must follow the instructions very carefully when submitting their manuscripts. Manuscript must be send electronically in both: MS Word 2003 for Windows (doc) and Acrobat (pdf) formats by e-mail: editor@sensorsportal.com

Page 15

设为首页 | 加入收藏 | 昂纲搜索

All Rights Reserved Powered by 文档下载网

Copyright © 2011
文档下载网内容来自网络,如有侵犯请和我们联系。tousu#anggang.com
返回顶部